| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.021690 |
| Chromosome: | chromosome 16 |
| Location: | 5302945 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g683900 | GDPD2,GDP2 | (1 of 3) K01126 - glycerophosphoryl diester phosphodiesterase (E3.1.4.46, glpQ, ugpQ); Glycerophosphoryl diester phosphodiesterase family protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGTGCTATTCGAAACTGGAATTGCCGCAGCAGCCTGCCCATACGACCC |
| Internal bar code: | AAGCGCGTCTCAGTTACGGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 186 |
| LEAP-Seq percent confirming: | 69.2308 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGTGCGAGATAGGGAGAC |
| Suggested primer 2: | TAACGCCATCCAGTCCAACC |