| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.021714 |
| Chromosome: | chromosome 1 |
| Location: | 4876458 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g033950 | EXN2 | 3'-5' exonuclease with GRF zinc finger domain; (1 of 1) K18417 - ERI1 exoribonuclease 2 [EC:3.1.-.-] (ERI2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGGGCAGGGGCAGCAGGGGCAGCAGGGGCAGGGGCAGGGGCAGCAGGG |
| Internal bar code: | CAACCGTGAAGTTCATGAGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1473 |
| LEAP-Seq percent confirming: | 76.9231 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCAAAAACCGAGCCGCAAG |
| Suggested primer 2: | GAAAGGACACAACACACGCC |