| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.021750 |
| Chromosome: | chromosome 12 |
| Location: | 4587037 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g521700 | SSS6,SSS1A | Soluble starch synthase IA; (1 of 5) K00703 - starch synthase (E2.4.1.21, glgA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGACGTCAACCCCTTCCGCGGCGAGGGCTTCAGTCGCGCCGGCGGCAT |
| Internal bar code: | GATAGTTGTCTATATTTCCACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 984 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTAAGGAATGTGCCACCA |
| Suggested primer 2: | AGGGATGGTCATGACGGAGA |