| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.021777 |
| Chromosome: | chromosome 3 |
| Location: | 6298168 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g192000 | SEC13L,SEH1 | COP-II coat subunit, nucleoporin; (1 of 1) K14299 - nucleoporin SEH1 (SEH1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATCGTGGTTGCGCTTTGCGACTTATCATGTGAGCCGTCTCGATGCCTG |
| Internal bar code: | AGCACACCAGTACATGTGTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1875 |
| LEAP-Seq percent confirming: | 97.4359 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGTTGGAGAAGGTGGGCT |
| Suggested primer 2: | CGCCCGTTACTCAGTTTCCT |