| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.022033 |
| Chromosome: | chromosome 2 |
| Location: | 2740528 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g093800 | NRX3 | Nucleoredoxin 3; (1 of 3) PTHR13871//PTHR13871:SF38 - THIOREDOXIN // PROTEIN C32D5.8, ISOFORM B-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGAACTCTTCTTTGCCAAGGGGAAACATAATGAGTGCGCACCTGTCC |
| Internal bar code: | TAATTATTTGATTTCAATTACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2182 |
| LEAP-Seq percent confirming: | 48.3871 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACCATGACAGGGACCTTC |
| Suggested primer 2: | ATTTTGGTTTGGCAGGTCGC |