| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.022133 |
| Chromosome: | chromosome 6 |
| Location: | 1198682 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g258363 | (1 of 1) IPR000048//IPR001611//IPR003591 - IQ motif, EF-hand binding site // Leucine-rich repeat // Leucine-rich repeat, typical subtype | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCGTAGTCGCCGGCGCCGCTGGTACGGCGTCGGTTGTCGTACGACGGC |
| Internal bar code: | GCGCGGAACTTCCCCTAATAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2177 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGCCATGATGCAACAACA |
| Suggested primer 2: | ACACTCAACCAAGAGCTCCG |