Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.022197 |
Chromosome: | chromosome 10 |
Location: | 5152733 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g455600 | DIV74,ORC1 | Origin recognition complex subunit 1; (1 of 1) K02603 - origin recognition complex subunit 1 (ORC1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGGCTGGGGCAGTGAGTTGGGCTGTTGGGCGCAAACAGAACCAACTG |
Internal bar code: | TCTTGCACGGGCGAGTCCCCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1174 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGGTCGTCGTACTCGTATT |
Suggested primer 2: | AATTGCCCGTATGCCTGGAA |