| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.022233 |
| Chromosome: | chromosome 17 |
| Location: | 2835062 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g718500 | MMP2,MMP1,GLE1 | (1 of 2) IPR008752//IPR016517 - Peptidase M11, gametolysin // Peptidase M11, autolysin; Matrix metalloproteinase, gamete lytic enzyme (G-lysin) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGATCATGTTGTCATCGCGGGTGCCCTGGGCGGGGATGACCAGGCCCC |
| Internal bar code: | ACGGTTAATGATACACCGTACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1130 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACGACGACTGGTGGGATCT |
| Suggested primer 2: | ATCAACAGCAACACCGCAAC |