| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.022241 |
| Chromosome: | chromosome 3 |
| Location: | 5529050 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g185000 | GTR8,BGS2,CALS2 | Callose synthase 2; (1 of 2) K11000 - callose synthase [EC:2.4.1.-] Glc b1-3 Glc (CALS) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGTCACCTGCGCCGCCGCCACAACCGCTCCTCTGGCGGCGGCGCCAGC |
| Internal bar code: | GCTGGAACTCCTGAACGATTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6825 |
| LEAP-Seq percent confirming: | 12.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATGAGCTTCTCAGGCGAT |
| Suggested primer 2: | TTCGTACCACGTGCTACGAC |