| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.022244 |
| Chromosome: | chromosome 12 |
| Location: | 748096 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g492600 | FAP346,FAS3 | FAS Domain Flagellar Associated Protein 346; (1 of 10) PTHR10900 - PERIOSTIN-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTAATGCGCTGCGGCAAGGTGTCCGCTAGCGAGGCATGAGACAAGGAC |
| Internal bar code: | TATGTCTTCTGATTCGGTATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 386 |
| LEAP-Seq percent confirming: | 41.6667 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCACCGAGTAGACCGAGTA |
| Suggested primer 2: | CTTGGGCTAGGCACTCGTAG |