| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.022332 |
| Chromosome: | chromosome 6 |
| Location: | 6107708 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g291200 | Histone H4 acetyltransferase, NuA4 complex-related; (1 of 2) K11344 - chromatin modification-related protein EAF6 (EAF6) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCCAAACACTGGAATGCTCCACTGCAAGTCGACCGCTAGCATGCCTCT |
| Internal bar code: | TGCCGGGCCAAATCCCATAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2447 |
| LEAP-Seq percent confirming: | 96.3415 |
| LEAP-Seq n confirming: | 79 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGTCGGAGCACACCTATC |
| Suggested primer 2: | CAAGTGTCAAAACCAGGCCG |