| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.022336 |
| Chromosome: | chromosome 8 |
| Location: | 4027682 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g382650 | UBQ4 | (1 of 2) K09313 - homeobox protein cut-like (CUTL); Bi-ubiquitin | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCTGGCGGCGCTGGAGCGCGAGCGAGAGACGCTGGTGGCGAAGCTGC |
| Internal bar code: | TCATTGGTAGTACAACAACGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 722 |
| LEAP-Seq percent confirming: | 64.2857 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCCATACACACGACACAT |
| Suggested primer 2: | TCCACACACACACACACACA |