| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.022444 |
| Chromosome: | chromosome 1 |
| Location: | 5250664 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g036800 | KIN9-1,KIN9A | Kinesin motor protein; (1 of 1) PTHR24115//PTHR24115:SF194 - FAMILY NOT NAMED // KINESIN-LIKE PROTEIN KIF6 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCGCCCGTGCACAGTCACTTACCGCATTGGCGACATGGCCGGGCTGGG |
| Internal bar code: | TGCAAGAAATGTCCTTACGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1819 |
| LEAP-Seq percent confirming: | 96.7742 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAATGACTCCAAGGTGGGC |
| Suggested primer 2: | AAGGACCGGCTCCATTCTTG |