Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.022485 |
Chromosome: | chromosome 7 |
Location: | 3745679 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g338150 | RNP1,ChlMEI2g,MEI2,AML1 | MEI2 RNA binding protein; (1 of 2) K17579 - protein phosphatase 1 regulatory subunit 42 (PPP1R42, LRRC67) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCCACTTCTGCGCGCCCAAGGGCGACCCCACCGTCAGCCAGGTGCGTC |
Internal bar code: | CAAGAAATACCTAGTCCAGTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1323 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAAAACAATGGGCCGTACGC |
Suggested primer 2: | CGGCGAACAATGCGACTAAG |