| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.022564 |
| Chromosome: | chromosome 5 |
| Location: | 229839 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g243050 | TRX3,TRXf2,TRXF2 | (1 of 1) PTHR10438:SF258 - THIOREDOXIN F1, CHLOROPLASTIC-RELATED; Thioredoxin f2, chloroplastic | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCGACGCTTGCGCACTCTCTGTGAACTGGTTCGTTATGTAGGGCCGT |
| Internal bar code: | TTTGAAACGGCTTAAGTGAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 663 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGTGGTGTGAGCGTGAAG |
| Suggested primer 2: | AGTGTGTGGAATAGTGCGCA |