| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.022664 |
| Chromosome: | chromosome 3 |
| Location: | 4444591 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g175500 | (1 of 2) K05770 - benzodiazapine receptor (BZRP) | CDS | |
| Cre03.g175550 | (1 of 38) IPR002048//IPR011992 - EF-hand domain // EF-hand domain pair | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCAAACCAACCTTACAAAATCTAAGATGGCATCACGAGGACTTCTCGA |
| Internal bar code: | CAGGTGTAATGCAATGAGATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4518 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 138 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 138 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCAGGGAACGAAGATGAA |
| Suggested primer 2: | TGAGAGCCGGGAGATTGAGA |