| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.022750 |
| Chromosome: | chromosome 12 |
| Location: | 7814983 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g553900 | CNG2 | (1 of 1) K04905 - potassium voltage-gated channel Eag-related subfamily H member 2 (KCNH2); Cyclic-nucleotide gated potassium channel | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGCTTTGTATGCGCCGCGCCCTGGGCGCGCTACAACGGTGACCCAGCA |
| Internal bar code: | TGAGTATGCTGAGCGATTGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2065 |
| LEAP-Seq percent confirming: | 93.8775 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCGCTGCCTTCTAGTGCTC |
| Suggested primer 2: | ATGATCAGCTTGTCGCCCAA |