Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.022839 |
Chromosome: | chromosome 7 |
Location: | 3450330 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g335600 | NAR1D | Formate/nitrite transporter; (1 of 7) PTHR30520//PTHR30520:SF0 - FORMATE TRANSPORTER-RELATED // FORMATE TRANSPORTER 1-RELATED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGTCACCTTTCGCCCCACAGGCGCCGGTGCCGTCCCCTCGTCCGCATA |
Internal bar code: | ATGTTTTGCCTATTAAATAAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1964 |
LEAP-Seq percent confirming: | 94.1176 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTACGTTCGCTTCACAGCCT |
Suggested primer 2: | TTGAGAAACTTGCGCCTTGC |