| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.022936 |
| Chromosome: | chromosome 1 |
| Location: | 6677454 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g047550 | RAB6,RABH1 | Small Rab-related GTPase; (1 of 1) K07893 - Ras-related protein Rab-6A (RAB6A) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCTGCCCTCAATCCGACCCCAACCTTCATTCCGTGGGCCCTGGAACTC |
| Internal bar code: | TGTTAGCCATTATCACAGAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 827 |
| LEAP-Seq percent confirming: | 83.871 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACCTCCATCATCACCCGA |
| Suggested primer 2: | CATCCGTTGCTGCATCCATG |