| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.022941 |
| Chromosome: | chromosome 2 |
| Location: | 2948569 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095250 | (1 of 1) 6.6.1.2 - Cobaltochelatase / Hydrogenobyrinic acid a,c-diamide cobaltochelatase | CDS | |
| Cre02.g800209 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTTGGGGTCGGCGAGGGAGGCGCTGCGGGTGGCCGCCACAGTAAGGCG |
| Internal bar code: | CCGTTCAGAGGGGTAGCTAAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5294 |
| LEAP-Seq percent confirming: | 95.5556 |
| LEAP-Seq n confirming: | 86 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 90 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGGCTCTGAAGGACACTG |
| Suggested primer 2: | GCATCATCGTCGCTCTGGTA |