| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.022989 |
| Chromosome: | chromosome 17 |
| Location: | 2745373 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g717800 | NUP93 | Nucleoporin 93; (1 of 1) K14309 - nuclear pore complex protein Nup93 (NUP93, NIC96) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGATGTTGAGTGATGGGTAGCCGGGGGCTGCGGCCCTTGAATCTCCGCA |
| Internal bar code: | TGCCTTACGGCGGTTACCTAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1690 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCCACATGAAGTCCTCAA |
| Suggested primer 2: | TGCTGTGCCATTTTGACTGC |