| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.022994 |
| Chromosome: | chromosome 12 |
| Location: | 9867018 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g544752 | (1 of 26) IPR013026//IPR019734 - Tetratricopeptide repeat-containing domain // Tetratricopeptide repeat | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCAACCTCCCTTCCGCTCGTCATCCACCTATCAGTCGCGGCGCTCCTC |
| Internal bar code: | TTGTTACATAGCCGTAAACTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1870 |
| LEAP-Seq percent confirming: | 84.2105 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTTTCTCGTCAGCTGCAT |
| Suggested primer 2: | TGTTGGACTGCCTGAAGGAC |