Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.023012 |
Chromosome: | chromosome 1 |
Location: | 7859694 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g055420 | PP2A1,PP2A-B,PF4 | (1 of 1) K04354 - serine/threonine-protein phosphatase 2A regulatory subunit B (PPP2R2); Phosphatase PP2A, B subunit | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGTCCCGGCAGCCTGACGGCACTCCCGCTTGCCACCCCTCCCCGCGAC |
Internal bar code: | ACAATTTAATGATACATAGTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2471 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGTGGAGCATCGTTTGAGT |
Suggested primer 2: | TTGCGTGCGTGAAAACGATT |