| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.023073 |
| Chromosome: | chromosome 4 |
| Location: | 1945263 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g218650 | UCP3 | (1 of 1) K15112 - solute carrier family 25 (mitochondrial uncoupling protein), member 27 (SLC25A27, UCP4); mitochondrial uncoupling protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACGCGTGTCTCCCGTATCCCACCTTGGAAGGGTACCTGGCGGGTGGGC |
| Internal bar code: | GAGGTCTCTAGTGGGGAAGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1089 |
| LEAP-Seq percent confirming: | 68.75 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGGCCGGCATAACGTAGA |
| Suggested primer 2: | GGAAACGCTGAGTGAGGTGA |