Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.023080 |
Chromosome: | chromosome 12 |
Location: | 1512416 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g487850 | CGL49,ARL11 | (1 of 1) K07977 - Arf/Sar family, other (ARF); ARF/SAR superfamily small monomeric GTP binding protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCACGTACACCAGAAGCAAATACCACATTTTTAGATACCCCTTCTGC |
Internal bar code: | ACATGATCGAAGCCACAGGCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3955 |
LEAP-Seq percent confirming: | 98.8095 |
LEAP-Seq n confirming: | 83 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 84 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCCTATGGGCTGCATCGT |
Suggested primer 2: | TCAGGAGCGAGTCACAACAC |