| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.023085 |
| Chromosome: | chromosome 7 |
| Location: | 4179781 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g342200 | Dyf-1Fleer,FAP259,IFT70,CrDYF-1,Ttc30 | Intraflagellar Transport Protein 70; (1 of 2) PF13414//PF14559 - TPR repeat (TPR_11) // Tetratricopeptide repeat (TPR_19) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGACGTGCCTTGTCCGAAAGGAACCAGCCGCCCGCCGTCAGAAGTGGA |
| Internal bar code: | GTAGACGAGCTGTGGCGCTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1166 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTTGGAGAGTTGGAAGGCG |
| Suggested primer 2: | AGGCCCAACTGCTATCAACC |