| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.023152 |
| Chromosome: | chromosome 12 |
| Location: | 7734871 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g554650 | REC8 | cohesin complex subunit, putative meiotic isoform; (1 of 3) PF04824 - Conserved region of Rad21 / Rec8 like protein (Rad21_Rec8) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATGTCGCCCGCCCGGGAGTAGGCTGCGTTGTCCCATGAACAGACTGCT |
| Internal bar code: | GTTAACATTCTTCTTGGCGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3162 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCCACTGTGCAAACATCAA |
| Suggested primer 2: | CCGAGGACAACGAGGGTAAG |