Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.023155 |
Chromosome: | chromosome 2 |
Location: | 6397043 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g388150 | MRPL36,bL36m | Mitochondrial ribosomal protein L36; (1 of 1) PTHR18804:SF13 - 39S RIBOSOMAL PROTEIN L36, MITOCHONDRIAL | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATAGTACAGCATCAGCCGAGCCAGTACGTATGTGGCAACATGTGTGTC |
Internal bar code: | TCGTTTATACCTAGAGGGGGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1728 |
LEAP-Seq percent confirming: | 88.0 |
LEAP-Seq n confirming: | 22 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGTTCCGTTTCGAGGACTG |
Suggested primer 2: | TCGAGTACACGCGATGGATG |