Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.023318 |
Chromosome: | chromosome 1 |
Location: | 3183570 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g020264 | VPS30,ATG6,APG6 | (1 of 1) K08334 - beclin 1 (BECN1, VPS30, ATG6); Autophagy-related protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGTTGATGGGTACAAGACGAGGGCAGCGCGTCGTACGCGGAGTGGTG |
Internal bar code: | GGGTACCAGCTCTGCGGTATGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 279 |
LEAP-Seq percent confirming: | 61.5385 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACACACACATGCACATGC |
Suggested primer 2: | CACCAACCTTTCTTGCTGCC |