| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.023337 |
| Chromosome: | chromosome 14 |
| Location: | 3015648 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g627700 | (1 of 1) IPR002893//IPR016166 - Zinc finger, MYND-type // FAD-binding, type 2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAAGTTAATGCACGACCCCACGATGGAAGCGCACGTGAGCAGCGATCCC |
| Internal bar code: | ATATTATAGCTGGCAGTATTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4418 |
| LEAP-Seq percent confirming: | 91.6667 |
| LEAP-Seq n confirming: | 88 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 96 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTTACCGCGCAGTACGTA |
| Suggested primer 2: | GTGCTCCTTCTGCATCAGGT |