| Insertion cassette: | CIB2 | 
| Side of cassette: | 5' | 
| Strand: | + | 
| Strain: | CLIP2.023415 | 
| Chromosome: | chromosome 1 | 
| Location: | 2548299 | 
| Confidence (%): | 80 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre01.g015100 | CSB5 | (1 of 70) PF07282 - Putative transposase DNA-binding domain (OrfB_Zn_ribbon); {"Probable transposon-derived protein of Chlamydomonas-Specific family B | intron | 
| Cre01.g015103 | Solute-binding protein-like adenylate cyclase; (1 of 7) PF00211//PF13416 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Bacterial extracellular solute-binding protein (SBP_bac_8) | 3'UTR_intron | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCCACCCACCTTGGAGGTCTTGTATTCATCGATGATGAACACATGCTT | 
| Internal bar code: | CTCTGTGAAGTTGAGAAATACC | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5391 | 
| LEAP-Seq percent confirming: | 91.4286 | 
| LEAP-Seq n confirming: | 64 | 
| LEAP-Seq n nonconfirming: | 6 | 
| LEAP-Seq n unique pos: | 70 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTGTGAACGTTTTGCCAT | 
| Suggested primer 2: | CGTTATCAACCCAGCCACCT |