Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.023455 |
Chromosome: | chromosome 12 |
Location: | 1739640 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g486209 | (1 of 1) K09533 - DnaJ homolog subfamily C member 13 (DNAJC13) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCTCCGCACCCCTCTGCGCAACAGCCAGCGCCGCCATCTCAGCCCCAG |
Internal bar code: | CGACTTTCACAGTATCCAGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 398 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAGGAGGAGGGGAAGATGT |
Suggested primer 2: | CGCTAAAACACGTTGTGCGA |