| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.023521 |
| Chromosome: | chromosome 10 |
| Location: | 4005511 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g447350 | SEC23B | (1 of 1) PF04810//PF04811 - Sec23/Sec24 zinc finger (zf-Sec23_Sec24) // Sec23/Sec24 trunk domain (Sec23_trunk); COP-II coat subunit | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGTTGCTTGCTGAGCTGCGCCGCCACCGCCTGCCCCAGCTGCTGCAGC |
| Internal bar code: | CATTAATCAAACTTTCCCTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1307 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACGCGCTCTACCACTTCAC |
| Suggested primer 2: | GTTCCTCCGCACTCCAGAAA |