| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.023562 |
| Chromosome: | chromosome 4 |
| Location: | 1131794 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g215900 | (1 of 2) IPR006212//IPR009030//IPR011641 - Furin-like repeat // Insulin-like growth factor binding protein, N-terminal // Tyrosine-protein kinase ephrin type A/B receptor-like | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAGGTTTGCCCCGCCGGCACGATTGCCGCCTTCGCGCCCGACATGGGT |
| Internal bar code: | CAGGCTGGCAAATCAACTAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1545 |
| LEAP-Seq percent confirming: | 24.2424 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCAAAGGGGGAAGGCAGT |
| Suggested primer 2: | TCTGACACGTACGGGACTCT |