| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.023673 |
| Chromosome: | chromosome 10 |
| Location: | 5388640 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g457100 | (1 of 1) 1.13.11.79 - 5,6-dimethylbenzimidazole synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACCAGGTTTCGTAGAAGGTGCCTTGTCATCCCTACAAGTTTACGCACT |
| Internal bar code: | GGTTTTTCGAACATTTTGGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4534 |
| LEAP-Seq percent confirming: | 98.5507 |
| LEAP-Seq n confirming: | 68 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGACCTTACCTCGATGAGC |
| Suggested primer 2: | GACCTTCCATTCAGTCGGCA |