Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.023752 |
Chromosome: | chromosome 2 |
Location: | 3305507 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g097650 | RPN6 | (1 of 1) K03036 - 26S proteasome regulatory subunit N6 (PSMD11, RPN6); 26S proteasome regulatory subunit | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCATTGTTGACCAGGCACAGCAATCCGACAGCCAACACCCCACCCCTCC |
Internal bar code: | GACTAATCGACGACTGCCCCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2967 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCGACAGCATTGCGAAGG |
Suggested primer 2: | TCTCCCTTCCTCTCAGCCTC |