Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.023754 |
Chromosome: | chromosome 5 |
Location: | 319924 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g800515 | (1 of 4) IPR000595//IPR003938//IPR005821//IPR018490 - Cyclic nucleotide-binding domain // Potassium channel, voltage-dependent, EAG/ELK/ERG // Ion transport domain // Cyclic nucleotide-binding-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAATGCAATATTGGGATCTAAATCACATATTGAGTGAGTTACTGCTCT |
Internal bar code: | GTATCTGGGGCGTCGGGGGCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 542 |
LEAP-Seq percent confirming: | 70.0 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCTGGGAGTTGAGGAAGTC |
Suggested primer 2: | GGCACCTCCAACAAGTACGA |