| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.023772 |
| Chromosome: | chromosome 15 |
| Location: | 1713092 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g801742 | (1 of 1) PF00078//PF00385//PF00665//PF13650 - Reverse transcriptase (RNA-dependent DNA polymerase) (RVT_1) // Chromo (CHRromatin Organisation MOdifier) domain (Chromo) // Integrase core domain (rve) // Aspartyl protease (Asp_protease_2) | 5'UTR | |
| Cre15.g801743 | (1 of 34) IPR001878 - Zinc finger, CCHC-type | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCCGTTGCGCTCGCCATCAGCGGCTACAGGCACATTACCACCTACCGG |
| Internal bar code: | TTTGCGGTGTCAGGTTAAGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1825 |
| LEAP-Seq percent confirming: | 27.2727 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATATCGCCGACGTCAAGG |
| Suggested primer 2: | GTCACGCATCATGTAACGCC |