| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.023778 |
| Chromosome: | chromosome 12 |
| Location: | 5349594 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g528850 | DLC3,ODA-LC3,DLX1 | Flagellar Outer Arm Dynein Light Chain 3, thioredoxin; (1 of 7) 3.5.1.52 - Peptide-N(4)-(N-acetyl-beta-glucosaminyl)asparagine amidase / N-oligosaccharide glycopeptidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGTACAGGCACCAATGACTCCATCCCGTTCCGTGCAAGGACCCGGGA |
| Internal bar code: | ACTCAAACTTTCTGGATAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2396 |
| LEAP-Seq percent confirming: | 96.6102 |
| LEAP-Seq n confirming: | 57 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGTGTTTGACGACCAACC |
| Suggested primer 2: | TAGCTGCTCACTTCTTGCCC |