| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.023805 |
| Chromosome: | chromosome 7 |
| Location: | 582744 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g316600 | MKP5 | (1 of 3) K04459 - dual specificity MAP kinase phosphatase (DUSP, MKP); Dual-specificity protein phosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTTGGGTGGGGTGTGTGCGGGTGGCAGCATACCCCGCGTCGTCCCCAT |
| Internal bar code: | TGAGTGCTCTAGGCGGGTATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3608 |
| LEAP-Seq percent confirming: | 95.082 |
| LEAP-Seq n confirming: | 116 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 122 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGATAAGCCATGCACAGC |
| Suggested primer 2: | GTGCGTTCACACTGGTGTTC |