| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.023813 |
| Chromosome: | chromosome 14 |
| Location: | 1150265 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g615050 | (1 of 1) 1.3.1.38//1.3.1.93 - Trans-2-enoyl-CoA reductase (NADPH) // Very-long-chain enoyl-CoA reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCGCACCCACCAGAAGTTGCCGAGCTGCGCGAGCACCGCCGCGGCCAG |
| Internal bar code: | GAATCGACCATCGTTTTGAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 190 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGTAGGTCAGCAGGAGAG |
| Suggested primer 2: | ATTCCCCCTCTCCAGGTCTC |