| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.023849 |
| Chromosome: | chromosome 17 |
| Location: | 4001980 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g728300 | FAP226,CAL6 | Flagellar Associated Protein 226; (1 of 3) 3.4.22.54 - Calpain-3 / Muscle-specific calcium-activated neutral protease 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGTGCCTTCAACGGTATGCCCAACCCCCAACGCCGTGACGGCCCTGTC |
| Internal bar code: | CCGCTTGCCCACATTAGATGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3325 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 107 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 107 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCATCTTGATAGCGCGCCA |
| Suggested primer 2: | TTCGCAAATTTGGGTGCAGG |