Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.023935 |
Chromosome: | chromosome 1 |
Location: | 1623788 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g008850 | HLM2 | (1 of 1) PF12931//PF12932 - Sec23-binding domain of Sec16 (Sec16_C) // Vesicle coat trafficking protein Sec16 mid-region (Sec16); Histone-lysine N-methyltransferase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGGGTGGCGCGTCGGTGCCGCCGGCTGCCTTGGGGCCCATCGCGCCGT |
Internal bar code: | CCGAGCAAATAAGACTAGCAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1106 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCGAATCAAAGCTGGTGG |
Suggested primer 2: | GTACGGCAGGATCCAGGAAG |