| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.023973 |
| Chromosome: | chromosome 2 |
| Location: | 3908170 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g101800 | ARFB1,ARFB | Peptide chain release factor/ribosome rescue factor; (1 of 1) K15033 - peptidyl-tRNA hydrolase ICT1 [EC:3.1.1.29] (ICT1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGACGGGGTGACACCAGTGACACCCCCGCCGCCGAAGCCGGTGTACAAG |
| Internal bar code: | ATGTCGATCGAGTAACGGTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3693 |
| LEAP-Seq percent confirming: | 98.4615 |
| LEAP-Seq n confirming: | 64 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCACCAATTGCCGCATAGC |
| Suggested primer 2: | CCTTCAGGCGCCTGCTATAA |