| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.024037 |
| Chromosome: | chromosome 14 |
| Location: | 1195014 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g615600 | SDR35 | (1 of 3) IPR007751//IPR029058 - Domain of unknown function DUF676, lipase-like // Alpha/Beta hydrolase fold; Short-chain dehydrogenase/reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCGGTCTCACCGGTGATGAAGTTGACGGGGGTCACCCCGCCCTCGTCA |
| Internal bar code: | CTTCAGTTAGAAAGCGCCATAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3763 |
| LEAP-Seq percent confirming: | 98.8889 |
| LEAP-Seq n confirming: | 89 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 90 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAACAACCAGAAAACGCGT |
| Suggested primer 2: | AGCAGTGTCCTGGGTTAAGC |