Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.024079 |
Chromosome: | chromosome 16 |
Location: | 2510537 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g660601 | (1 of 1) IPR000772//IPR003609 - Ricin B, lectin domain // PAN/Apple domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTATCTGTGTACGGCACTGTGTGCGTGGCTCGCAAGGTTTAGCAGGACT |
Internal bar code: | AGGAGTGTCGGTATGGGCTAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 507 |
LEAP-Seq percent confirming: | 83.3333 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGCCGCTTTCTTGAATGG |
Suggested primer 2: | GGTTGTGTCCACATTGGTGC |