Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.024151 |
Chromosome: | chromosome 6 |
Location: | 4857118 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g280350 | (1 of 5) IPR001680//IPR011047//IPR017986//IPR020472 - WD40 repeat // Quinonprotein alcohol dehydrogenase-like superfamily // WD40-repeat-containing domain // G-protein beta WD-40 repeat | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTACGGATGTCCGCGCTGTGAACCTATGCCTGCACGTCTCGTCGGATGC |
Internal bar code: | CAAACGTTTTCGTTTAGAAAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 672 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGCCAAGGAAGACAGACCG |
Suggested primer 2: | ATCCTGGCGCTCAAGTTTGA |