| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.024172 |
| Chromosome: | chromosome 2 |
| Location: | 2492895 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g092000 | DEG2 | Deg protease; (1 of 5) 3.4.21.108 - HtrA2 peptidase / Serine proteinase OMI | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCATGGCAGAAGGAGGCGTAAACAACAGCGCACATCTCTAGCAGGTGCA |
| Internal bar code: | TATATGTCATCGCATTTCTATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1027 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCGCGCTACTTCATCTAC |
| Suggested primer 2: | AGCCATCGATCAGCAGGATG |