| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.024291 |
| Chromosome: | chromosome 13 |
| Location: | 403203 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g564650 | MRS5 | Magnesium and cobalt transport protein; (1 of 3) 3.6.3.2 - Magnesium-importing ATPase / Mg(2+)-importing ATPase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCTGCGGCCACTCACAACAAGCTACTTACACACAATACAAGTTTGCGT |
| Internal bar code: | CATTGAAGGGCGGCTTTCGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1860 |
| LEAP-Seq percent confirming: | 47.973 |
| LEAP-Seq n confirming: | 71 |
| LEAP-Seq n nonconfirming: | 77 |
| LEAP-Seq n unique pos: | 148 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCTCGGTACTCAGGTGGG |
| Suggested primer 2: | AGTGGCCTCGTTTCCTTGAG |