| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.024297 |
| Chromosome: | chromosome 9 |
| Location: | 5491803 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g801072 | (1 of 1) IPR026849//IPR026854 - Autophagy-related protein 2 // Vacuolar protein sorting-associated protein 13A, N-terminal domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAAACTGTGCGTGCCAAATAGTTGGCGAGGTCGGCCGCTGCCCGCGAC |
| Internal bar code: | AAAATCGTGTAATGTCTAGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4682 |
| LEAP-Seq percent confirming: | 94.9153 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCCCCAAGACTGAGAAG |
| Suggested primer 2: | ATGTCTTGTGCAAAACCGCC |